NovoPro
Cart 2
  • FFAR4 Human  cDNA/ORF Clones

FFAR4 Human cDNA/ORF Clones

Cat.#: 701168-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 212.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    free fatty acid receptor 4
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    FFAR4
  • Gene Type
    protein coding
  • Also Known as
    GT01; PGR4; BMIQ10; GPR120; GPR129; O3FAR1
  • Encoded Protein Alias
    free fatty acid receptor 4; G-protein coupled receptor 120; G-protein coupled receptor 129; G-protein coupled receptor GT01; G-protein coupled receptor PGR4; omega-3 fatty acid receptor 1
  • Product Name
    FFAR4(NM_181745) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens free fatty acid receptor 4 (FFAR4), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1134
  • Annotation
    This variant (1) encodes the longer isoform (GPR120-L).
  • siRNA

    ACAUGACACUGUGCAGGAAtt

    CAAGAGCUGUCGUGACUCAtt

    UGGUCAUUGUGAUCAGUUAtt

    CAGUUACUCCAAAAUUUUAtt

  • DataSheet:
  • Product Name
    FFAR4(XM_011539746) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens free fatty acid receptor 4 (FFAR4), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    723
  • siRNA

    CAAGAGCUGUCGUGACUCAtt

    UGGUCAUUGUGAUCAGUUAtt

    CAGUUACUCCAAAAUUUUAtt

  • DataSheet:
  • Product Name
    FFAR4(NM_001195755) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens free fatty acid receptor 4 (FFAR4), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1086
  • Annotation
    This variant (2) is missing an in-frame coding exon compared to variant 1, resulting in a shorter isoform (GPR120-S) lacking a 16 aa protein segment compared to isoform GPR120-L.
  • siRNA

    ACAUGACACUGUGCAGGAAtt

    UGGUCAUUGUGAUCAGUUAtt

    CAGUUACUCCAAAAUUUUAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"