NovoPro
Cart 2
  • FOXP2 Chimpanzee  cDNA/ORF Clones

FOXP2 Chimpanzee cDNA/ORF Clones

Cat.#: 732617-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 368.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    forkhead box P2
  • Organism
    Chimpanzee
  • Entrez Gene ID
  • Gene Symbol
    FOXP2
  • Gene Type
    protein coding
  • Encoded Protein Alias
    Forkhead box protein P2
  • Product Name
    FOXP2(NM_001009020) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pan troglodytes forkhead box P2 (FOXP2), mRNA.
  • Synonyms
  • ORF length
    2151
  • DataSheet:
  • Product Name
    FOXP2(XM_009454013) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes forkhead box P2 (FOXP2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1875
  • DataSheet:
  • Product Name
    FOXP2(XM_009454011) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes forkhead box P2 (FOXP2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2202
  • DataSheet:
  • Product Name
    FOXP2(XM_009454010) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes forkhead box P2 (FOXP2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2226
  • DataSheet:
  • Product Name
    FOXP2(XM_016956790) Chimpanzee cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pan troglodytes forkhead box P2 (FOXP2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2277
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"