NovoPro
Cart 2
  • Flt1 Mouse  cDNA/ORF Clones

Flt1 Mouse cDNA/ORF Clones

Cat.#: 709909-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 352.4 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    FMS-like tyrosine kinase 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Flt1
  • Gene Type
    protein coding
  • Also Known as
    Flt-1; sFlt1; VEGFR1; VEGFR-1; AI323757
  • Encoded Protein Alias
    vascular endothelial growth factor receptor 1; embryonic receptor kinase 2; tyrosine-protein kinase receptor FLT; vascular endothelial growth factor receptor-1; vascular permeability factor receptor
  • Product Name
    Flt1(NM_010228) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus FMS-like tyrosine kinase 1 (Flt1), mRNA.
  • Synonyms
  • ORF length
    4002
  • siRNA

    GCAUCUAUAAGGCAGCGGAtt

    CGAUCUUGCUGGGCAUAAAtt

    GAAGCGGUCUUCUUCCGAAtt

  • DataSheet:
  • Product Name
    Flt1(XM_011241000) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus FMS-like tyrosine kinase 1 (Flt1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2256
  • siRNA
  • DataSheet:
  • Product Name
    Flt1(XM_006504803) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus FMS-like tyrosine kinase 1 (Flt1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2127
  • siRNA
  • DataSheet:
  • Product Name
    Flt1(XM_006504801) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus FMS-like tyrosine kinase 1 (Flt1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2595
  • siRNA
  • DataSheet:
  • Product Name
    Flt1(XM_006504802) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus FMS-like tyrosine kinase 1 (Flt1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2172
  • siRNA
  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"