NovoPro
Cart 2
  • Fgf8 Mouse  cDNA/ORF Clones

Fgf8 Mouse cDNA/ORF Clones

Cat.#: 709848-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    fibroblast growth factor 8
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Fgf8
  • Gene Type
    protein coding
  • Also Known as
    Aigf; Fgf-8
  • Encoded Protein Alias
    fibroblast growth factor 8; HBGF-8; androgen-induced growth factor; heparin-binding growth factor 8
  • Product Name
    Fgf8(NM_001166361) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus fibroblast growth factor 8 (Fgf8), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    735
  • Annotation
    This variant (2) has an alternate internal 5' coding region, as compared to variant 1. The reading frame is not changed and the resulting isoform (2) is shorter and has a different segment in the N-terminal region, as compared to isoform 1.
  • siRNA

    AGGACUGCGUAUUCACAGAtt

    GUCUCUACAUCUGCAUGAAtt

  • DataSheet:
  • Product Name
    Fgf8(XM_006526668) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus fibroblast growth factor 8 (Fgf8), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    702
  • siRNA
  • DataSheet:
  • Product Name
    Fgf8(NM_133286) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus fibroblast growth factor 8 (Fgf8), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    615
  • Annotation
    This variant (4) lacks an internal segment in the 5' coding region, as compared to variant 1. The reading frame is not changed and the resulting isoform (4) lacks an internal segment in the N-terminal region, as compared to isoform 1.
  • siRNA

    GCUCAUUGUGGAGACCGAUtt

    AGAGCAACGGCAAAGGCAAtt

    AGGACUGCGUGUUCACGGAtt

    CCAUGGCAGAAGACGGAGAtt

    CCAUGGCAGAAGACGGAGAtt

  • DataSheet:
  • Product Name
    Fgf8(NM_010205) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus fibroblast growth factor 8 (Fgf8), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    807
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    AGGACUGCGUAUUCACAGAtt

    GUCUCUACAUCUGCAUGAAtt

    CGACAUGUGAGGGAGCAGAtt

  • DataSheet:
  • Product Name
    Fgf8(NM_006119) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus fibroblast growth factor 8 (Fgf8), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    648
  • Annotation
    This variant (3) has an alternate internal 5' coding region, as compared to variant 1. The reading frame is not changed and the resulting isoform (3) is shorter and has a different segment in the N-terminal region, as compared to isoform 1.
  • siRNA

    CGUGGAGACGGACACCUUUtt

    AGAGCAACGGCAAAGGCAAtt

    ACAUCUGCAUGAACAAGAAtt

  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"