Cart 2
  • FGF1 Human  cDNA/ORF Clone

FGF1 Human cDNA/ORF Clone

Cat.#: 714365-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 5-8 days
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    fibroblast growth factor 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    FGF1
  • Gene Type
    protein coding
  • Also Known as
    AFGF; ECGF; FGFA; ECGFA; ECGFB; FGF-1; HBGF1; HBGF-1; GLIO703; ECGF-beta; FGF-alpha
  • Encoded Protein Alias
    fibroblast growth factor 1; beta-endothelial cell growth factor; endothelial cell growth factor, alpha; endothelial cell growth factor, beta; heparin-binding growth factor 1
  • Product Name
    FGF1(NM_033137) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens fibroblast growth factor 1 (FGF1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    180
  • Annotation
    This variant (3) uses an alternate splice site and lacks a coding exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.
  • siRNA

    CCCAAACUCCUCUACUGUAtt

    CCUCCAGGGAAUUACAAGAtt

    GCAUCUCCAUGUAGAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    FGF1(NM_033136) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens fibroblast growth factor 1 (FGF1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    183
  • Annotation
    This variant (2) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
  • siRNA

    CCCAAACUCCUCUACUGUAtt

    CCUCCAGGGAAUUACAAGAtt

    GCAUCUCCAUGUAGAAUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    FGF1(NM_001257212) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens fibroblast growth factor 1 (FGF1), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    465
  • Annotation
    This variant (8) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, but maintains the reading frame, compared to variant 1. Variants 8, 13 and 14 encode isoform 4, which is shorter than isoform 1.
  • siRNA

    CCCAAACUCCUCUACUGUAtt

    CCUCCAGGGAAUUACAAGAtt

    GCAUCUCCAUGUAGAAUAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"