NovoPro
Cart 2
  • FCHO2 Human  cDNA/ORF Clones

FCHO2 Human cDNA/ORF Clones

Cat.#: 719286-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 399.0 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    FCH domain only 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    FCHO2
  • Gene Type
    protein coding
  • Encoded Protein Alias
    FCH domain only protein 2
  • Product Name
    FCHO2(XM_017009016) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens FCH domain only 2 (FCHO2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2328
  • siRNA

    CCACGACACUUGCAGUACAtt

    GCAUACUCCAGGUCAAUGAtt

    CAGUACAGAUGAAUCGGAAtt

  • DataSheet:
  • Product Name
    FCHO2(XM_017009017) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens FCH domain only 2 (FCHO2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1707
  • siRNA

    GCAUACUCCAGGUCAAUGAtt

    CAGUACAGAUGAAUCGGAAtt

  • DataSheet:
  • Product Name
    FCHO2(XM_017009022) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens FCH domain only 2 (FCHO2), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1482
  • siRNA

    GCAUACUCCAGGUCAAUGAtt

    CAGUACAGAUGAAUCGGAAtt

  • DataSheet:
  • Product Name
    FCHO2(XM_017009023) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens FCH domain only 2 (FCHO2), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1272
  • siRNA

    GCAUACUCCAGGUCAAUGAtt

    CAGUACAGAUGAAUCGGAAtt

  • DataSheet:
  • Product Name
    FCHO2(XM_017009018) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens FCH domain only 2 (FCHO2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1695
  • siRNA

    GCAUACUCCAGGUCAAUGAtt

    CAGUACAGAUGAAUCGGAAtt

  • DataSheet:
  • Product Name
    FCHO2(NM_001146032) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens FCH domain only 2 (FCHO2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2334
  • Annotation
    This variant (2) lacks an in-frame exon compared to variant 1. The encoded isoform (b) is shorter compared to isoform a.
  • siRNA

    CCACGACACUUGCAGUACAtt

    GCAUACUCCAGGUCAAUGAtt

    CAGUACAGAUGAAUCGGAAtt

  • DataSheet:
  • Product Name
    FCHO2(NM_138782) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens FCH domain only 2 (FCHO2), transcript variant 1, mRNA.
  • Synonyms
    XM_291142  
  • ORF length
    2433
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (a).
  • siRNA

    CCACGACACUUGCAGUACAtt

    GCAUACUCCAGGUCAAUGAtt

    CAGUACAGAUGAAUCGGAAtt

  • DataSheet:
  • Product Name
    FCHO2(XM_017009019) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens FCH domain only 2 (FCHO2), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1674
  • siRNA

    GCAUACUCCAGGUCAAUGAtt

    CAGUACAGAUGAAUCGGAAtt

  • DataSheet:
  • Product Name
    FCHO2(XM_017009020) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens FCH domain only 2 (FCHO2), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1557
  • siRNA

    GCAUACUCCAGGUCAAUGAtt

    CAGUACAGAUGAAUCGGAAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"