NovoPro
Cart 2
  • FCRL1 Human  cDNA/ORF Clones

FCRL1 Human cDNA/ORF Clones

Cat.#: 703248-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 187.9 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    Fc receptor like 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    FCRL1
  • Gene Type
    protein coding
  • Also Known as
    FCRH1; IFGP1; IRTA5; CD307a
  • Encoded Protein Alias
    Fc receptor-like protein 1; IFGP family protein 1; fc receptor homolog 1; fcR-like protein 1; hIFGP1; immune receptor translocation-associated protein 5; immunoglobulin superfamily Fc receptor, gp42
  • Product Name
    FCRL1(XM_005244869) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    1002
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_011509132) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1188
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_011509126) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1272
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_011509128) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1230
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_017000227) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    1065
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_011509135) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    1023
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(NM_001159398) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens Fc receptor like 1 (FCRL1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1287
  • Annotation
    This variant (3) uses an alternate in-frame splice site in the 3' coding region compared to variant 1. This variant encodes isoform 3, which is shorter than isoform 1.
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_005244867) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    1173
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_011509130) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1215
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_011509129) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1227
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_011509127) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1269
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_011509136) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    900
  • siRNA

    GGAGAUCCCAGAUAAAUGUtt

  • DataSheet:
  • Product Name
    FCRL1(XM_005244866) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1218
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(NM_001159397) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens Fc receptor like 1 (FCRL1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1101
  • Annotation
    This variant (2) uses an alternate exon in the 3' coding region compared to variant 1, that results in a frameshift. This variant encodes isoform 2, which is shorter and has a distinct C-terminus compared to isoform 1.
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_011509137) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    660
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Product Name
    FCRL1(XM_011509125) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc receptor like 1 (FCRL1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1275
  • siRNA

    CUACAGCCUAUAUAUGAAAtt

    GGAGAUCCCAGAUAAAUGUtt

    GGAGGACAAGGUUUCCUUAtt

  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-C-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"