NovoPro
Cart 2
  • FCAR Human  cDNA/ORF Clones

FCAR Human cDNA/ORF Clones

Cat.#: 714005-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    Fc fragment of IgA receptor
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    FCAR
  • Gene Type
    protein coding
  • Also Known as
    CD89; FcalphaRI; CTB-61M7.2
  • Encoded Protein Alias
    immunoglobulin alpha Fc receptor; Fc alpha receptor; Fc fragment of IgA, receptor for
  • Product Name
    FCAR(NM_133273) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens Fc fragment of IgA receptor (FCAR), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    540
  • Annotation
    This variant (5, also known as U10) lacks alternate in-frame exons in the 5' and 3' coding region, compared to variant 1. The encoded isoform (e) is shorter than isoform a.
  • siRNA

    CCAUACUGGUUGAAAAUUGtt

    AGGCCAUUCGUGAAGCUUAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

  • DataSheet:
  • Product Name
    FCAR(NM_133269) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens Fc fragment of IgA receptor (FCAR), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    798
  • Annotation
    This variant (2, also known as a.2, delta66EC2, or U06) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a.
  • siRNA

    CCAUACUGGUUGAAAAUUGtt

    CAUCCCAUUUGAUAGAUUUtt

    AGGCCAUUCGUGAAGCUUAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

  • DataSheet:
  • Product Name
    FCAR(NM_133272) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens Fc fragment of IgA receptor (FCAR), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    828
  • Annotation
    This variant (4, also known as deltaS2 or U11) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (d) is shorter than isoform a.
  • siRNA

    CCAUACUGGUUGAAAAUUGtt

    CAUCCCAUUUGAUAGAUUUtt

    AGGCCAUUCGUGAAGCUUAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

  • DataSheet:
  • Product Name
    FCAR(NM_002000) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens Fc fragment of IgA receptor (FCAR), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    864
  • Annotation
    This variant (1, also known as a.1) represents the longest transcript and encodes the longest isoform (a).
  • siRNA

    CCAUACUGGUUGAAAAUUGtt

    CAUCCCAUUUGAUAGAUUUtt

    AGGCCAUUCGUGAAGCUUAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Product Name
    FCAR(NM_133278) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens Fc fragment of IgA receptor (FCAR), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    762
  • Annotation
    This variant (8, also known as deltaS266Ec2 or U13) lacks an in-frame exon in the 5' coding region and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (h) is shorter than isoform a.
  • siRNA

    CCAUACUGGUUGAAAAUUGtt

    CAUCCCAUUUGAUAGAUUUtt

    AGGCCAUUCGUGAAGCUUAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

  • DataSheet:
  • Product Name
    FCAR(NM_133277) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens Fc fragment of IgA receptor (FCAR), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    537
  • Annotation
    This variant (7, also known as deltaS2ECl or L10) lacks two in-frame exons in the 5' coding region, compared to variant 1. The encoded isoform (g) is shorter than isoform a.
  • siRNA

    CCAUACUGGUUGAAAAUUGtt

    CAUCCCAUUUGAUAGAUUUtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

  • DataSheet:
  • Product Name
    FCAR(NM_133271) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens Fc fragment of IgA receptor (FCAR), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    576
  • Annotation
    This variant (3, also known as a.3, Rla2, deltaE2, or U08) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The encoded isoform (c) is shorter than isoform a.
  • siRNA

    CCAUACUGGUUGAAAAUUGtt

    AGGCCAUUCGUGAAGCUUAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

  • DataSheet:
  • Product Name
    FCAR(XM_011526625) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens Fc fragment of IgA receptor (FCAR), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    783
  • siRNA

    CCAUACUGGUUGAAAAUUGtt

    CAUCCCAUUUGAUAGAUUUtt

    AGGCCAUUCGUGAAGCUUAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

  • DataSheet:
  • Product Name
    FCAR(NM_133274) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens Fc fragment of IgA receptor (FCAR), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    630
  • Annotation
    This variant (6, also known as U09) lacks an in-frame exon in the 5' coding region and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (f) has a distinct C-terminus and is shorter than isoform a.
  • siRNA

    CCAUACUGGUUGAAAAUUGtt

    CAUCCCAUUUGAUAGAUUUtt

    AGGCCAUUCGUGAAGCUUAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

    GCACAUAAGUUAUGGUUUUtt

    GGAUUGACCUUUGCACGAAtt

  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"