NovoPro
Cart 2
  • EGFR Human  cDNA/ORF Clones

EGFR Human cDNA/ORF Clones

Cat.#: 714305-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 309.1 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    epidermal growth factor receptor
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    EGFR
  • Gene Type
    protein coding
  • Also Known as
    ERBB; HER1; mENA; ERBB1; PIG61; NISBD2
  • Encoded Protein Alias
    epidermal growth factor receptor; avian erythroblastic leukemia viral (v-erb-b) oncogene homolog; cell growth inhibiting protein 40; cell proliferation-inducing protein 61; erb-b2 receptor tyrosine kinase 1; proto-oncogene c-ErbB-1; receptor tyrosine-protein kinase erbB-1
  • Product Name
    EGFR(NM_201282) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1887
  • Annotation
    This variant (2) uses a different 3' terminal exon when compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus. Only the extracellular domain is present in isoform b.
  • siRNA

    GAAUAGGUAUUGGUGAAUUtt

    CCAUAAAUGCUACGAAUAUtt

    GAUCUUUCCUUCUUAAAGAtt

  • DataSheet:
  • Product Name
    EGFR(NM_201283) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1218
  • Annotation
    This variant (3, also known as ErbB1-S) uses a different 3' terminal exon when compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus. Only the extracellular domain is present in isoform c.
  • siRNA

    GAAUAGGUAUUGGUGAAUUtt

    CCAUAAAUGCUACGAAUAUtt

    GAUCUUUCCUUCUUAAAGAtt

  • DataSheet:
  • Product Name
    EGFR(NM_001346941) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens epidermal growth factor receptor (EGFR), transcript variant EGFRvIII, mRNA.
  • Synonyms
  • ORF length
    2832
  • Annotation
    This variant (EGFRvIII, also known as delta-EGFR and de2-7EGFR) has an in-frame deletion of six exons in the 5' coding region, compared to variant 1. The encoded isoform (i) has a shorter extracellular domain compared to isoform a. This variant is considered to be tumorigenic and the encoded protein lacks normal ligand binding ability and is constitutively active (PMID: 23777544).
  • siRNA
  • DataSheet:
  • Product Name
    EGFR(NM_201284) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    2118
  • Annotation
    This variant (4) uses a different 3' terminal exon when compared to variant 1. The resulting isoform (d) has a shorter and distinct C-terminus. Only the extracellular domain is present in isoform d.
  • siRNA

    GAAUAGGUAUUGGUGAAUUtt

    CCAUAAAUGCUACGAAUAUtt

    GAUCUUUCCUUCUUAAAGAtt

  • DataSheet:
  • Product Name
    EGFR(NM_001346897) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    3276
  • Annotation
    This variant (5) lacks an in-frame exon in the 5' coding region and its 3' terminal exon extends past a splice site that is used in variant 1. The encoded isoform (e) is shorter and has a distinct C-terminus compared to isoform a.
  • siRNA
  • DataSheet:
  • Product Name
    EGFR(NM_001346899) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    3498
  • Annotation
    This variant (7) lacks an in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (g) is shorter than isoform a.
  • siRNA
  • DataSheet:
  • Product Name
    EGFR(NM_001346898) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    3411
  • Annotation
    This variant (6) has a 3' terminal exon that extends past a splice site that is used in variant 1. The encoded isoform (f) has a shorter and distinct C-terminus compared to isoform a.
  • siRNA
  • DataSheet:
  • Product Name
    EGFR(NM_001346900) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    3474
  • Annotation
    This variant (8) uses a novel 5' terminal exon compared to variant 1. The encoded isoform (h) has a shorter and distinct N-terminus compared to isoform a.
  • siRNA
  • DataSheet:
  • Vector Name
    pEXP-C-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-His
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    His
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-Myc
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    Myc
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-mOrange2
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6662
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    OFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pEXP-N-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6013
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-His
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    His
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-N-Myc
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6019
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    Myc
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-SP-N-HA
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6061
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    HA
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"