NovoPro
Cart 2
  • Egfr Rat  cDNA/ORF Clones

Egfr Rat cDNA/ORF Clones

Cat.#: 708396-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 871.2 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    epidermal growth factor receptor
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Egfr
  • Gene Type
    protein coding
  • Also Known as
    Errp; ERBB1; ErbB-1
  • Encoded Protein Alias
    epidermal growth factor receptor; EGFR-related peptide; Epidermal growth factor receptor formerly avian erythroblastic leukemia viral (v-erbB) oncogene homolog (Erbb1); avian erythroblastic leukemia viral (v-erbB) oncogene homolog; epidermal growth factor receptor, formerly avian erythroblastic leukemia viral (v-erbB) oncogene homolog (Erbb1)
  • Product Name
    Egfr(NM_031507) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus epidermal growth factor receptor (Egfr), mRNA.
  • Synonyms
    XM_346468  
  • ORF length
    3630
  • siRNA

    CACGGGAACUAGAAAUUCUtt

    CAGCUUGUCCGAAAACGUAtt

    GCCCAAUCAAAAGACCAAAtt

  • DataSheet:
  • Product Name
    Egfr(XM_008770416) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus epidermal growth factor receptor (Egfr), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    3729
  • siRNA

    CACGGGAACUAGAAAUUCUtt

    GCCCAAUCAAAAGACCAAAtt

  • DataSheet:
  • Product Name
    Egfr(XM_017599073) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus epidermal growth factor receptor (Egfr), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    3645
  • siRNA
  • DataSheet:
  • Product Name
    Egfr(XM_008770418) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus epidermal growth factor receptor (Egfr), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2034
  • siRNA

    CACGGGAACUAGAAAUUCUtt

    GCCCAAUCAAAAGACCAAAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"