NovoPro
Cart 2
  • EBNA1BP2 Human  cDNA/ORF Clones

EBNA1BP2 Human cDNA/ORF Clones

Cat.#: 710205-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    EBNA1 binding protein 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    EBNA1BP2
  • Gene Type
    protein coding
  • Also Known as
    P40; EBP2; NOBP
  • Encoded Protein Alias
    probable rRNA-processing protein EBP2; EBNA1-binding protein 2; nuclear FGF3 binding protein; nucleolar protein p40; nucleolar protein p40; homolog of yeast EBNA1-binding protein
  • Product Name
    EBNA1BP2(NM_006824) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens EBNA1 binding protein 2 (EBNA1BP2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    921
  • Annotation
    This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
  • siRNA

    GGAAGAAGGUGCAAACGGAtt

    CGACGGUAUAAAAACCAGAtt

    CACUGAUUAUUUUGCGGAAtt

  • DataSheet:
  • DataSheet:
  • Product Name
    EBNA1BP2(NM_001159936) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens EBNA1 binding protein 2 (EBNA1BP2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1086
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GGAAGAAGGUGCAAACGGAtt

    CGACGGUAUAAAAACCAGAtt

    CACUGAUUAUUUUGCGGAAtt

  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"