NovoPro
Cart 2
  • Dync1i2 Mouse  cDNA/ORF Clones

Dync1i2 Mouse cDNA/ORF Clones

Cat.#: 749555-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 328.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    dynein cytoplasmic 1 intermediate chain 2
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Dync1i2
  • Gene Type
    protein coding
  • Also Known as
    Dncic2; AW554389; 3110079H08Rik
  • Encoded Protein Alias
    DH IC-2; cytoplasmic dynein intermediate chain 2 isoform 2.1; cytoplasmic dynein intermediate chain 2 isoform 2.2; cytoplasmic dynein intermediate chain 2 isoform 2.5; dynein intermediate chain 2, cytosolic; dynein, cytoplasmic, intermediate chain 2
  • Product Name
    Dync1i2(A2BFF5) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus dynein cytoplasmic 1 intermediate chain 2 (Dync1i2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1914
  • siRNA
  • DataSheet:
  • Product Name
    Dync1i2(NM_001198874) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus dynein cytoplasmic 1 intermediate chain 2 (Dync1i2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1899
  • Annotation
    This variant (3; also called 1a.B) lacks multiple exons in the 5' coding region, compared to variant 1. Variant 3 encodes a shorter isoform (3), compared to isoform 1.
  • siRNA

    GCAUCGAGUUGUUAGUUGUtt

    GCAUGGGACUAACUACGGAtt

    GGCAGUAGCUGUAACAUCUtt

  • DataSheet:
  • Product Name
    Dync1i2(XM_006498680) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus dynein cytoplasmic 1 intermediate chain 2 (Dync1i2), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1602
  • siRNA
  • DataSheet:
  • Product Name
    Dync1i2(XM_017315324) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus dynein cytoplasmic 1 intermediate chain 2 (Dync1i2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1896
  • siRNA
  • DataSheet:
  • Product Name
    Dync1i2(NM_010064) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus dynein cytoplasmic 1 intermediate chain 2 (Dync1i2), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1839
  • Annotation
    This variant (5; also called 1a.C) lacks multiple exons in the 5' coding region, compared to variant 1. Variant 5 encodes a shorter isoform (5), compared to isoform 1. Variants 5 and 8 encode the same protein.
  • siRNA

    GCAUCGAGUUGUUAGUUGUtt

    GCAUGGGACUAACUACGGAtt

    GGCAGUAGCUGUAACAUCUtt

  • DataSheet:
  • Product Name
    Dync1i2(A2BFF8) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus dynein cytoplasmic 1 intermediate chain 2 (Dync1i2), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1836
  • siRNA
  • DataSheet:
  • Product Name
    Dync1i2(NM_001198872) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus dynein cytoplasmic 1 intermediate chain 2 (Dync1i2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1968
  • Annotation
    This variant (1; also called 1a.D) represents the longest transcript and encodes the longest isoform (1). Variants 1 and 6 encode the same protein.
  • siRNA

    GCAUCGAGUUGUUAGUUGUtt

    GCAUGGGACUAACUACGGAtt

    GGCAGUAGCUGUAACAUCUtt

  • DataSheet:
  • Product Name
    Dync1i2(NM_001198873) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus dynein cytoplasmic 1 intermediate chain 2 (Dync1i2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1953
  • Annotation
    This variant (2; also called 1a.E) uses an alternate splice acceptor site in the 5' coding region, compared to variant 1. Variant 2 encodes a shorter isoform (2), compared to isoform 1. Variants 2 and 7 encode the same protein.
  • siRNA

    GCAUCGAGUUGUUAGUUGUtt

    GCAUGGGACUAACUACGGAtt

    GGCAGUAGCUGUAACAUCUtt

  • DataSheet:
  • Product Name
    Dync1i2(NM_001198875) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus dynein cytoplasmic 1 intermediate chain 2 (Dync1i2), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1857
  • Annotation
    This variant (4; also called 1a.F) lacks multiple exons in the 5' coding region, compared to variant 1. Variant 4 encodes a shorter isoform (4), compared to isoform 1.
  • siRNA

    GCAUCGAGUUGUUAGUUGUtt

    GCAUGGGACUAACUACGGAtt

    GGCAGUAGCUGUAACAUCUtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"