NovoPro
Cart 2
  • DYNC1I2 Pongo abelii  cDNA/ORF Clones

DYNC1I2 Pongo abelii cDNA/ORF Clones

Cat.#: 720506-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 328.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    dynein cytoplasmic 1 intermediate chain 2
  • Organism
    Pongo abelii
  • Entrez Gene ID
  • Gene Symbol
    DYNC1I2
  • Gene Type
    protein coding
  • Encoded Protein Alias
    DH IC-2; cytoplasmic dynein intermediate chain 2; dynein intermediate chain 2, cytosolic
  • Product Name
    DYNC1I2(NM_001135354) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pongo abelii dynein cytoplasmic 1 intermediate chain 2 (DYNC1I2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1914
  • DataSheet:
  • Product Name
    DYNC1I2(NM_001133616) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pongo abelii dynein cytoplasmic 1 intermediate chain 2 (DYNC1I2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1917
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"