NovoPro
Cart 2
  • Dpysl2 Mouse  cDNA/ORF Clone

Dpysl2 Mouse cDNA/ORF Clone

Cat.#: 749611-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 294.6 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    dihydropyrimidinase-like 2
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Dpysl2
  • Gene Type
    protein coding
  • Also Known as
    DRP2; Crmp2; Ulip2; TOAD-64; AI851130; Musunc33
  • Encoded Protein Alias
    DRP-2; ULIP-2; collapsin response mediator protein 2; unc-33-like phosphoprotein 2
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"