NovoPro
Cart 2
  • DCLK2 Human  cDNA/ORF Clones

DCLK2 Human cDNA/ORF Clones

Cat.#: 702686-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 440.4 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    doublecortin like kinase 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    DCLK2
  • Gene Type
    protein coding
  • Also Known as
    CL2; DCK2; CLIK2; DCDC3; CLICK2; DCDC3B; DCAMKL2; CLICK-II
  • Encoded Protein Alias
    serine/threonine-protein kinase DCLK2; CaMK-like CREB regulatory kinase 2; doublecortin and CaM kinase-like 2; doublecortin domain-containing protein 3B; doublecortin-like and CAM kinase-like 2
  • Product Name
    DCLK2(XM_005262785) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens doublecortin like kinase 2 (DCLK2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2349
  • siRNA

    CAGAUGCUCUGAAUCAUCAtt

    GAUCCUCAGCUGUUAAGUAtt

    GCAAUUUUGCAGUAGUCAAtt

  • DataSheet:
  • Product Name
    DCLK2(NM_001040260) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens doublecortin like kinase 2 (DCLK2), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2301
  • Annotation
    This variant (1) is known as exon-5-lacking transcript (PMIDs:15611072 and 18075264). It lacks an in-frame coding exon in the 5' region, as compared to variant 2. The resulting isoform (a) lacks an internal segment, as compared to isoform b.
  • siRNA

    CAGAUGCUCUGAAUCAUCAtt

    GAUCCUCAGCUGUUAAGUAtt

    GCAAUUUUGCAGUAGUCAAtt

  • DataSheet:
  • Product Name
    DCLK2(XM_017007833) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens doublecortin like kinase 2 (DCLK2), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    2085
  • siRNA

    CAGAUGCUCUGAAUCAUCAtt

    GAUCCUCAGCUGUUAAGUAtt

    GCAAUUUUGCAGUAGUCAAtt

  • DataSheet:
  • Product Name
    DCLK2(XM_017007832) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens doublecortin like kinase 2 (DCLK2), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2154
  • siRNA

    CAGAUGCUCUGAAUCAUCAtt

    GAUCCUCAGCUGUUAAGUAtt

    GCAAUUUUGCAGUAGUCAAtt

  • DataSheet:
  • Product Name
    DCLK2(XM_005262786) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens doublecortin like kinase 2 (DCLK2), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2298
  • siRNA

    CAGAUGCUCUGAAUCAUCAtt

    GAUCCUCAGCUGUUAAGUAtt

    GCAAUUUUGCAGUAGUCAAtt

  • DataSheet:
  • Product Name
    DCLK2(NM_001040261) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens doublecortin like kinase 2 (DCLK2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2352
  • Annotation
    This variant (2) is known as exon-5-containing transcript (PMIDs:15611072 and 18075264) and encodes the longer isoform (b).
  • siRNA

    CAGAUGCUCUGAAUCAUCAtt

    GAUCCUCAGCUGUUAAGUAtt

    GCAAUUUUGCAGUAGUCAAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"