NovoPro
Cart 2
  • DYNC1I2 Human  cDNA/ORF Clones

DYNC1I2 Human cDNA/ORF Clones

Cat.#: 715561-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 325.5 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    dynein cytoplasmic 1 intermediate chain 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    DYNC1I2
  • Gene Type
    protein coding
  • Also Known as
    IC2; DIC74; DNCI2
  • Encoded Protein Alias
    DH IC-2; dynein intermediate chain 2, cytosolic; dynein, cytoplasmic, intermediate polypeptide 2
  • Product Name
    DYNC1I2(NM_001320882) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens dynein cytoplasmic 1 intermediate chain 2 (DYNC1I2), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    1899
  • Annotation
    This variant (9) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (5) has the same N- and C-termini but is shorter compared to isoform 1. Both variants 9 and 10 encode the same isoform (5).
  • siRNA

    GUAGGUGACAAAUAUCUAAtt

    CCAUGUGGUAUAUACUAUAtt

    GCAAAUCACAUGUUCCUCAtt

    GCCGCAUUCUUUAUAUGUAtt

    AGGAAUAAUUGACCUGGAAtt

    AAAACAGAAUGUGAACAUUtt

    GUGCUCAAAUGGACCCAUAtt

    AGACAAUAUCUCAAGUUAUtt

    AUGUAGUUACUGUAUCUUUtt

    CAUUAUGAAUUGAUGUCUAtt

    GACAGAUUGUUAUAUACGAtt

    CUCGAGAAAUUGUCACGUAtt

    GCUUCACUCAGAUUCCGAUtt

  • DataSheet:
  • Product Name
    DYNC1I2(XM_017003525) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens dynein cytoplasmic 1 intermediate chain 2 (DYNC1I2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1896
  • siRNA

    GACAGAUUGUUAUAUACGAtt

    CUCGAGAAAUUGUCACGUAtt

    GCUUCACUCAGAUUCCGAUtt

  • DataSheet:
  • Product Name
    DYNC1I2(NM_001271789) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens dynein cytoplasmic 1 intermediate chain 2 (DYNC1I2), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1839
  • Annotation
    This variant (5) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1. Both variants 5 and 6 encode the same isoform (3).
  • siRNA

    GUAGGUGACAAAUAUCUAAtt

    CCAUGUGGUAUAUACUAUAtt

    GCAAAUCACAUGUUCCUCAtt

    GCCGCAUUCUUUAUAUGUAtt

    AGGAAUAAUUGACCUGGAAtt

    AAAACAGAAUGUGAACAUUtt

    GUGCUCAAAUGGACCCAUAtt

    AGACAAUAUCUCAAGUUAUtt

    AUGUAGUUACUGUAUCUUUtt

    CAUUAUGAAUUGAUGUCUAtt

    GACAGAUUGUUAUAUACGAtt

    CUCGAGAAAUUGUCACGUAtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Product Name
    DYNC1I2(NM_001271787) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens dynein cytoplasmic 1 intermediate chain 2 (DYNC1I2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1893
  • Annotation
    This variant (3) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter and contains an additional internal region, compared to isoform 1. Both variants 3 and 4 encode the same isoform (2).
  • siRNA

    GUAGGUGACAAAUAUCUAAtt

    CCAUGUGGUAUAUACUAUAtt

    GCAAAUCACAUGUUCCUCAtt

    GCCGCAUUCUUUAUAUGUAtt

    AGGAAUAAUUGACCUGGAAtt

    AAAACAGAAUGUGAACAUUtt

    GUGCUCAAAUGGACCCAUAtt

    AGACAAUAUCUCAAGUUAUtt

    AUGUAGUUACUGUAUCUUUtt

    CAUUAUGAAUUGAUGUCUAtt

    GACAGAUUGUUAUAUACGAtt

    CUCGAGAAAUUGUCACGUAtt

  • DataSheet:
  • Product Name
    DYNC1I2(NM_001320884) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens dynein cytoplasmic 1 intermediate chain 2 (DYNC1I2), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    1836
  • Annotation
    This variant (7) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (4) is shorter, compared to isoform 1. Both variants 7 and 8 encode the same isoform (4).
  • siRNA

    GUAGGUGACAAAUAUCUAAtt

    CCAUGUGGUAUAUACUAUAtt

    GCAAAUCACAUGUUCCUCAtt

    GCCGCAUUCUUUAUAUGUAtt

    AGGAAUAAUUGACCUGGAAtt

    AAAACAGAAUGUGAACAUUtt

    GUGCUCAAAUGGACCCAUAtt

    AGACAAUAUCUCAAGUUAUtt

    AUGUAGUUACUGUAUCUUUtt

    CAUUAUGAAUUGAUGUCUAtt

    GACAGAUUGUUAUAUACGAtt

    CUCGAGAAAUUGUCACGUAtt

  • DataSheet:
  • Product Name
    DYNC1I2(NM_001378) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens dynein cytoplasmic 1 intermediate chain 2 (DYNC1I2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1917
  • Annotation
    This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (1).
  • siRNA

    GUAGGUGACAAAUAUCUAAtt

    CCAUGUGGUAUAUACUAUAtt

    GCAAAUCACAUGUUCCUCAtt

    GCCGCAUUCUUUAUAUGUAtt

    AGGAAUAAUUGACCUGGAAtt

    AAAACAGAAUGUGAACAUUtt

    GUGCUCAAAUGGACCCAUAtt

    AGACAAUAUCUCAAGUUAUtt

    AUGUAGUUACUGUAUCUUUtt

    CAUUAUGAAUUGAUGUCUAtt

    GACAGAUUGUUAUAUACGAtt

    CUCGAGAAAUUGUCACGUAtt

    GCUUCACUCAGAUUCCGAUtt

  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"