NovoPro
Cart 2
  • DCAF15 Human  cDNA/ORF Clones

DCAF15 Human cDNA/ORF Clones

Cat.#: 703683-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 348.5 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    DDB1 and CUL4 associated factor 15
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    DCAF15
  • Gene Type
    protein coding
  • Also Known as
    C19orf72
  • Encoded Protein Alias
    DDB1- and CUL4-associated factor 15
  • Product Name
    DCAF15(NM_138353) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens DDB1 and CUL4 associated factor 15 (DCAF15), mRNA.
  • Synonyms
    XM_373433  
  • ORF length
    1803
  • siRNA

    GGAUGCUCAUGAACAUGAUtt

    CUAGACUUCGAAUAUGUUAtt

    CGACCUGUACCUGACCGUAtt

  • DataSheet:
  • DataSheet:
  • Vector Name
    pDONR223
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    5005
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Spectinomycin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors. The sequences of the attP1 and attP2 sites in pDONR223 are identical to those in the original pDONR201 Entry vector. Reference: Rual et al, Genome Res. 14:2128-2135, 2004. Requires ccdB resistant strain of bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"