NovoPro
Cart 2
  • Cdk1 Mouse  cDNA/ORF Clones

Cdk1 Mouse cDNA/ORF Clones

Cat.#: 709779-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 275.8 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cyclin-dependent kinase 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Cdk1
  • Gene Type
    protein coding
  • Also Known as
    Cdc2; Cdc2a; p34
  • Encoded Protein Alias
    cyclin-dependent kinase 1; cell cycle p34 CDC2 kinase protein; cell division control protein 2 homolog; cell division cycle 2 homolog A; cell division cycle control protein 2a; cell division protein kinase 1; p34 protein kinase
  • Product Name
    Cdk1(NM_007659) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus cyclin-dependent kinase 1 (Cdk1), mRNA.
  • Synonyms
  • ORF length
    894
  • siRNA

    GGUUGACAUCUGGAGUAUAtt

    CCAUGGACCUCAAGAAGUAtt

    GAACUUCGACAUCCAAAUAtt

  • DataSheet:
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"