NovoPro
Cart 2
  • CUX1 Human  cDNA/ORF Clone

CUX1 Human cDNA/ORF Clone

Cat.#: 748955-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 250.0 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cut like homeobox 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CUX1
  • Gene Type
    protein coding
  • Also Known as
    CDP; CUX; p75; CASP; CDP1; COY1; Clox; p100; p110; p200; CUTL1; GOLIM6; CDP/Cut; Cux/CDP; Nbla10317
  • Encoded Protein Alias
    CCAAT displacement protein; cut homolog; cut-like homeobox 1; golgi integral membrane protein 6; homeobox protein cux-1; putative protein product of Nbla10317
  • Product Name
    CUX1(NM_181500) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cut like homeobox 1 (CUX1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2031
  • Annotation
    This variant (3) lacks a 6 nt segment at an alternate splice site and has an alternate 3' sequence including the coding region, as compared to variant 4. The resulting isoform (c) lacks two internal amino acids and has a shorter and distinct C-terminus, as compared to isoform d.
  • siRNA

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(XM_005250150) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cut like homeobox 1 (CUX1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    4815
  • siRNA

    GCUGACUACUUUAAGAUUAtt

    CCCUUGGGCUUAAUCAGGAtt

    GGAUCUCAGCGUGUACUGAtt

    CAAAAGCCCAUAGACCUUAtt

    CGACUAAGGUUGGACUGGAtt

    GCUCAGCUGUUAAGAUCCAtt

    GAUCCCUUGUACCUCCAAAtt

    GCAGGUACCCAAUAAAGUUtt

    CUCUUAUCCCAAAAGAAUAtt

    AAGCAAAUCUUACUGAAAAtt

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(XM_011515823) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cut like homeobox 1 (CUX1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    4512
  • siRNA

    GCUGACUACUUUAAGAUUAtt

    CCCUUGGGCUUAAUCAGGAtt

    GGAUCUCAGCGUGUACUGAtt

    CAAAAGCCCAUAGACCUUAtt

    CGACUAAGGUUGGACUGGAtt

    GCUCAGCUGUUAAGAUCCAtt

    GAUCCCUUGUACCUCCAAAtt

    GCAGGUACCCAAUAAAGUUtt

    CUCUUAUCCCAAAAGAAUAtt

    AAGCAAAUCUUACUGAAAAtt

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(NM_001913) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cut like homeobox 1 (CUX1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2037
  • Annotation
    This variant (2) has an alternate 3' sequence including the coding region, as compared to variant 4. The resulting isoform (b) has a shorter and distinct C-terminus, as compared to isoform d.
  • siRNA

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(NM_181552) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cut like homeobox 1 (CUX1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    4518
  • Annotation
    This variant (1) has an alternate 5' exon, as compared to variant 4. The resulting isoform (a) has a shorter and distinct N-terminus, as compared to isoform d.
  • siRNA

    GCUGACUACUUUAAGAUUAtt

    CCCUUGGGCUUAAUCAGGAtt

    GGAUCUCAGCGUGUACUGAtt

    CAAAAGCCCAUAGACCUUAtt

    CGACUAAGGUUGGACUGGAtt

    GCUCAGCUGUUAAGAUCCAtt

    GAUCCCUUGUACCUCCAAAtt

    GCAGGUACCCAAUAAAGUUtt

    CUCUUAUCCCAAAAGAAUAtt

    AAGCAAAUCUUACUGAAAAtt

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(XM_011515825) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cut like homeobox 1 (CUX1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    4245
  • siRNA

    GCUGACUACUUUAAGAUUAtt

    CCCUUGGGCUUAAUCAGGAtt

    GGAUCUCAGCGUGUACUGAtt

    CAAAAGCCCAUAGACCUUAtt

    CGACUAAGGUUGGACUGGAtt

    GCUCAGCUGUUAAGAUCCAtt

    GAUCCCUUGUACCUCCAAAtt

    GCAGGUACCCAAUAAAGUUtt

    CUCUUAUCCCAAAAGAAUAtt

    AAGCAAAUCUUACUGAAAAtt

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(XM_006715854) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cut like homeobox 1 (CUX1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    4752
  • siRNA

    GCUGACUACUUUAAGAUUAtt

    CCCUUGGGCUUAAUCAGGAtt

    GGAUCUCAGCGUGUACUGAtt

    CAAAAGCCCAUAGACCUUAtt

    CGACUAAGGUUGGACUGGAtt

    GCUCAGCUGUUAAGAUCCAtt

    GAUCCCUUGUACCUCCAAAtt

    GCAGGUACCCAAUAAAGUUtt

    CUCUUAUCCCAAAAGAAUAtt

    AAGCAAAUCUUACUGAAAAtt

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(NM_001202544) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cut like homeobox 1 (CUX1), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1989
  • Annotation
    This variant (5) lacks an in-frame exon in the 5' region and has an alternate 3' sequence including the coding region, as compared to variant 1. The resulting isoform (e) lacks an internal segment and has a shorter and distinct C-terminus, as compared to isoform d.
  • siRNA

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(NM_001202543) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cut like homeobox 1 (CUX1), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    4551
  • Annotation
    This variant (4) encodes the longest isoform (d).
  • siRNA

    GCUGACUACUUUAAGAUUAtt

    CCCUUGGGCUUAAUCAGGAtt

    GGAUCUCAGCGUGUACUGAtt

    CAAAAGCCCAUAGACCUUAtt

    CGACUAAGGUUGGACUGGAtt

    GCUCAGCUGUUAAGAUCCAtt

    GAUCCCUUGUACCUCCAAAtt

    GCAGGUACCCAAUAAAGUUtt

    CUCUUAUCCCAAAAGAAUAtt

    AAGCAAAUCUUACUGAAAAtt

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(NM_001202546) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cut like homeobox 1 (CUX1), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    1920
  • Annotation
    This variant (7) lacks an in-frame exon in the 5' region and has an alternate 3' sequence including the coding region, as compared to variant 1. The resulting isoform (g) lacks an internal segment and has a shorter and distinct C-terminus, as compared to isoform d.
  • siRNA

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(NM_001202545) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cut like homeobox 1 (CUX1), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1899
  • Annotation
    This variant (6) lacks an in-frame exon in the 5' region and has an alternate 3' sequence including the coding region, as compared to variant 1. The resulting isoform (f) lacks an internal segment and has a shorter and distinct C-terminus, as compared to isoform d.
  • siRNA

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CUX1(XM_017011760) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cut like homeobox 1 (CUX1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    4479
  • siRNA

    GCUGACUACUUUAAGAUUAtt

    CCCUUGGGCUUAAUCAGGAtt

    GGAUCUCAGCGUGUACUGAtt

    CAAAAGCCCAUAGACCUUAtt

    CGACUAAGGUUGGACUGGAtt

    GCUCAGCUGUUAAGAUCCAtt

    GAUCCCUUGUACCUCCAAAtt

    GCAGGUACCCAAUAAAGUUtt

    CUCUUAUCCCAAAAGAAUAtt

    AAGCAAAUCUUACUGAAAAtt

    GAAAGCGGCUUAUCGAACAtt

    GCAUAAGGUUCAGAGCCUAtt

    GGAAGAAUACAACAAGGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"