NovoPro
Cart 2
  • C1QBP Human  cDNA/ORF Clones

C1QBP Human cDNA/ORF Clones

Cat.#: 714767-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 214.7 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    complement C1q binding protein
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    C1QBP
  • Gene Type
    protein coding
  • Also Known as
    p32; HABP1; gC1qR; GC1QBP; SF2p32; gC1Q-R
  • Encoded Protein Alias
    complement component 1 Q subcomponent-binding protein, mitochondrial; ASF/SF2-associated protein p32; C1q globular domain-binding protein; glycoprotein gC1qBP; hyaluronan-binding protein 1; mitochondrial matrix protein p32; p33; splicing factor SF2-associated protein
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"