Cart 2
  • CNGA3 Human  cDNA/ORF Clone

CNGA3 Human cDNA/ORF Clone

Cat.#: 715957-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 250.0 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cyclic nucleotide gated channel alpha 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CNGA3
  • Gene Type
    protein coding
  • Also Known as
    CNG3; ACHM2; CCNC1; CCNCa; CNCG3; CCNCalpha
  • Encoded Protein Alias
    CNG channel alpha-3; CNG-3; cone photoreceptor cGMP-gated channel alpha subunit; cone photoreceptor cGMP-gated channel subunit alpha; cyclic nucleotide-gated channel alpha-3
  • Product Name
    CNGA3(XM_006712243) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cyclic nucleotide gated channel alpha 3 (CNGA3), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2196
  • siRNA

    GGAAGUACAUUUACAGUCUtt

    CCAUGAUCUCGAAUAUGAAtt

    GAGCAAGGCUUAAUGGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CNGA3(XM_011510554) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens cyclic nucleotide gated channel alpha 3 (CNGA3), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2250
  • siRNA

    GGAAGUACAUUUACAGUCUtt

    CCAUGAUCUCGAAUAUGAAtt

    GAGCAAGGCUUAAUGGUCAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CNGA3(NM_001079878) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens cyclic nucleotide gated channel alpha 3 (CNGA3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2031
  • Annotation
    This variant (2) lacks an alternate in-frame exon in the coding region, compared to variant 1. The resulting protein (isoform 2) is shorter and lacks an internal segment, compared to isoform 1.
  • siRNA

    GGAAGUACAUUUACAGUCUtt

    CCAUGAUCUCGAAUAUGAAtt

    GAGCAAGGCUUAAUGGUCAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"