NovoPro
Cart 2
  • MAJIN Human  cDNA/ORF Clones

MAJIN Human cDNA/ORF Clones

Cat.#: 701916-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 165.4 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    membrane anchored junction protein
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MAJIN
  • Gene Type
    protein coding
  • Also Known as
    C11orf85
  • Encoded Protein Alias
    uncharacterized protein C11orf85
  • Product Name
    MAJIN(XM_011544940) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens membrane anchored junction protein (MAJIN), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    882
  • siRNA

    CUCUAUAUGUGGAGAUGAAtt

    GGAAGAGUAUCAGAGGAGAtt

  • DataSheet:
  • Product Name
    MAJIN(XM_006718505) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens membrane anchored junction protein (MAJIN), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    648
  • siRNA

    GGAAGAGUAUCAGAGGAGAtt

  • DataSheet:
  • Product Name
    MAJIN(NM_001318808) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens membrane anchored junction protein (MAJIN), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    447
  • Annotation
    This variant (3) uses an alternate splice junction and lacks an alternate coding exon compared to variant 1. The resulting isoform (3) is shorter at the N-terminus and has a distinct C-terminus compared to isoform 1.
  • siRNA

    CUCUAUAUGUGGAGAUGAAtt

    GGAAGAGUAUCAGAGGAGAtt

  • DataSheet:
  • Product Name
    MAJIN(XM_005273918) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens membrane anchored junction protein (MAJIN), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    765
  • siRNA

    CUCUAUAUGUGGAGAUGAAtt

    GGAAGAGUAUCAGAGGAGAtt

  • DataSheet:
  • Product Name
    MAJIN(NM_001037225) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens membrane anchored junction protein (MAJIN), transcript variant 1, mRNA.
  • Synonyms
    XM_208524  
  • ORF length
    651
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GACAGAAUAGGGAAAGAAAtt

    CUCUAUAUGUGGAGAUGAAtt

    GGAAGAGUAUCAGAGGAGAtt

  • DataSheet:
  • DataSheet:
  • Product Name
    MAJIN(XM_006718504) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens membrane anchored junction protein (MAJIN), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    768
  • siRNA

    GACAGAAUAGGGAAAGAAAtt

    CUCUAUAUGUGGAGAUGAAtt

    GGAAGAGUAUCAGAGGAGAtt

  • DataSheet:
  • Product Name
    MAJIN(NM_001300803) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens membrane anchored junction protein (MAJIN), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    531
  • Annotation
    This variant (2) lacks an alternate in-frame segment and contains an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (2) lacks an alternate internal segment and has a longer and distinct C-terminus compared to isoform 1.
  • siRNA

    GGAAGAGUAUCAGAGGAGAtt

  • DataSheet:
  • Product Name
    MAJIN(XM_011544941) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens membrane anchored junction protein (MAJIN), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    402
  • siRNA

    CUCUAUAUGUGGAGAUGAAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"