NovoPro
Cart 2
  • BORCS7 Human  cDNA/ORF Clones

BORCS7 Human cDNA/ORF Clones

Cat.#: 703219-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 275.8 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    BLOC-1 related complex subunit 7
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    BORCS7
  • Gene Type
    protein coding
  • Also Known as
    C10orf32
  • Encoded Protein Alias
    UPF0693 protein C10orf32
  • Product Name
    BORCS7(NM_144591) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BLOC-1 related complex subunit 7 (BORCS7), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    321
  • Annotation
    This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
  • siRNA

    CACCUGUGGUACUGACGUAtt

    CUCGAAACAUGGUACUCCAtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"