NovoPro
Cart 2
  • GOPC Human  cDNA/ORF Clones

GOPC Human cDNA/ORF Clones

Cat.#: 715443-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    golgi associated PDZ and coiled-coil motif containing
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    GOPC
  • Gene Type
    protein coding
  • Also Known as
    CAL; FIG; PIST; GOPC1; dJ94G16.2
  • Encoded Protein Alias
    CFTR-associated ligand; Golgi associated PDZ and coiled-coil motif containing protein; PDZ protein interacting specifically with TC10; PDZ/coiled-coil domain binding partner for the rho-family GTPase TC10; dJ94G16.2 PIST; fused in glioblastoma; golgi-associated PDZ and coiled-coil motif containing protein
  • Product Name
    GOPC(NM_001017408) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens golgi associated PDZ and coiled-coil motif containing (GOPC), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1365
  • Annotation
    This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.
  • siRNA

    GUACCUUGAUGAGUUAGAAtt

    GGAGUUAACCUAAGGGACAtt

    CCCUGGUGCUAGUUGCAAAtt

  • DataSheet:
  • DataSheet:
  • Product Name
    GOPC(NM_020399) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens golgi associated PDZ and coiled-coil motif containing (GOPC), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1389
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (a).
  • siRNA

    GUACCUUGAUGAGUUAGAAtt

    GGAGUUAACCUAAGGGACAtt

    CCCUGGUGCUAGUUGCAAAtt

  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"