NovoPro
Cart 2
  • CERS5 Human  cDNA/ORF Clones

CERS5 Human cDNA/ORF Clones

Cat.#: 703690-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 182.3 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    ceramide synthase 5
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CERS5
  • Gene Type
    protein coding
  • Also Known as
    Trh4; LASS5
  • Encoded Protein Alias
    ceramide synthase 5; LAG1 homolog, ceramide synthase 5; LAG1 longevity assurance homolog 5
  • Product Name
    CERS5(NM_001281731) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens ceramide synthase 5 (CERS5), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1005
  • Annotation
    This variant (2) contains an alternate exon in the 5' region and initiates translation at an alternate start codon compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.
  • siRNA

    CUACAUCAACAAUAUGGUUtt

    CCAUUGGGCUUAUCUCCUUtt

    GGAUUGGAAUGUCCGAAAAtt

  • DataSheet:
  • Product Name
    CERS5(XM_017020202) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ceramide synthase 5 (CERS5), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1005
  • siRNA

    CUACAUCAACAAUAUGGUUtt

    CCAUUGGGCUUAUCUCCUUtt

    GGAUUGGAAUGUCCGAAAAtt

  • DataSheet:
  • Product Name
    CERS5(XM_005269220) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ceramide synthase 5 (CERS5), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1230
  • siRNA

    CUACAUCAACAAUAUGGUUtt

    CCAUUGGGCUUAUCUCCUUtt

    GGAUUGGAAUGUCCGAAAAtt

  • DataSheet:
  • Product Name
    CERS5(XM_017020204) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens ceramide synthase 5 (CERS5), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    873
  • siRNA

    CUACAUCAACAAUAUGGUUtt

    CCAUUGGGCUUAUCUCCUUtt

    GGAUUGGAAUGUCCGAAAAtt

  • DataSheet:
  • Product Name
    CERS5(NM_001331072) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens ceramide synthase 5 (CERS5), transcript variant 10, mRNA.
  • Synonyms
  • ORF length
    747
  • siRNA
  • DataSheet:
  • Product Name
    CERS5(NM_147190) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens ceramide synthase 5 (CERS5), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1179
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    CUACAUCAACAAUAUGGUUtt

    CCAUUGGGCUUAUCUCCUUtt

    GGAUUGGAAUGUCCGAAAAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"