NovoPro
Cart 2
  • CDK1 Pongo abelii  cDNA/ORF Clones

CDK1 Pongo abelii cDNA/ORF Clones

Cat.#: 722109-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 167.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cyclin dependent kinase 1
  • Organism
    Pongo abelii
  • Entrez Gene ID
  • Gene Symbol
    CDK1
  • Gene Type
    protein coding
  • Also Known as
    CDC2
  • Encoded Protein Alias
    Cell division control protein 2 homolog; cell division cycle 2, G1 to S and G2 to M; cell division protein kinase 1; p34 protein kinase
  • Product Name
    CDK1(XM_009245577) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pongo abelii cyclin-dependent kinase 1 (CDK1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    894
  • DataSheet:
  • Product Name
    CDK1(NM_001131814) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pongo abelii cyclin dependent kinase 1 (CDK1), mRNA.
  • Synonyms
  • ORF length
    894
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"