NovoPro
Cart 2
  • CD96 Human  cDNA/ORF Clones

CD96 Human cDNA/ORF Clones

Cat.#: 710578-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 245.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD96 molecule
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CD96
  • Gene Type
    protein coding
  • Also Known as
    TACTILE
  • Encoded Protein Alias
    T-cell surface protein tactile; CD96 antigen; T cell activation, increased late expression; cell surface antigen CD96; t cell-activated increased late expression protein
  • Product Name
    CD96(XM_017005522) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens CD96 molecule (CD96), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1446
  • siRNA

    GUGUAUCUCCUGCAAGAUAtt

    GGCUCAACACUUCAUGACAtt

  • DataSheet:
  • Product Name
    CD96(NM_001318889) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens CD96 molecule (CD96), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1209
  • Annotation
    This variant (3) lacks several exons and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1.
  • siRNA

    GGUCCUAACAAAAUCUUGAtt

  • DataSheet:
  • Product Name
    CD96(XM_005247063) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens CD96 molecule (CD96), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1260
  • siRNA

    GGUCCUAACAAAAUCUUGAtt

  • DataSheet:
  • Product Name
    CD96(XM_006713469) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens CD96 molecule (CD96), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1755
  • siRNA

    GUGUAUCUCCUGCAAGAUAtt

    GGUCCUAACAAAAUCUUGAtt

    GGCUCAACACUUCAUGACAtt

  • DataSheet:
  • Product Name
    CD96(XM_006713470) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens CD96 molecule (CD96), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1707
  • siRNA

    GUGUAUCUCCUGCAAGAUAtt

    GGUCCUAACAAAAUCUUGAtt

    GGCUCAACACUUCAUGACAtt

  • DataSheet:
  • Product Name
    CD96(XM_017005521) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens CD96 molecule (CD96), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1569
  • siRNA

    GUGUAUCUCCUGCAAGAUAtt

    GGUCCUAACAAAAUCUUGAtt

    GGCUCAACACUUCAUGACAtt

  • DataSheet:
  • Product Name
    CD96(NM_198196) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens CD96 molecule (CD96), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1758
  • Annotation
    This variant (1) encodes the longer isoform (1).
  • siRNA

    GUGUAUCUCCUGCAAGAUAtt

    GGUCCUAACAAAAUCUUGAtt

    GGCUCAACACUUCAUGACAtt

  • DataSheet:
  • Vector Name
    pEXP-C-EGFP
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6703
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    GFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-C-mOrange2
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6662
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    OFPSpark
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-SP-N-FLAG
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6058
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    FLAG
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-SP-N-HA
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6061
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Hygromycin
  • Protein Tag
    HA
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"