NovoPro
Cart 2
  • Cd96 Rat  cDNA/ORF Clones

Cd96 Rat cDNA/ORF Clones

Cat.#: 700589-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 211.2 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD96 molecule
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Cd96
  • Gene Type
    protein coding
  • Encoded Protein Alias
    T-cell surface protein tactile; CD96 antigen; cell surface antigen CD96; t cell-activated increased late expression protein
  • Product Name
    Cd96(NM_001025032) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus CD96 molecule (Cd96), mRNA.
  • Synonyms
    XM_573281  
  • ORF length
    1812
  • siRNA

    CGAAGUAUCUCCUACAAGAtt

    CAUCAUCCGUACAACCAAAtt

    CUCUGAAGGAUGCAACGAAtt

  • DataSheet:
  • Product Name
    Cd96(XM_008768647) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus CD96 molecule (Cd96), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1821
  • siRNA

    CGAAGUAUCUCCUACAAGAtt

    CAUCAUCCGUACAACCAAAtt

    CUCUGAAGGAUGCAACGAAtt

  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"