Cart 2
  • Cd86 Rat  cDNA/ORF Clone

Cd86 Rat cDNA/ORF Clone

Cat.#: 706111-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 155.8 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD86 molecule
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Cd86
  • Gene Type
    protein coding
  • Also Known as
    B7-2
  • Encoded Protein Alias
    T-lymphocyte activation antigen CD86; cd86 antigen; membrane glycoprotein
  • Product Name
    Cd86(NM_020081) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus CD86 molecule (Cd86), mRNA.
  • Synonyms
  • ORF length
    942
  • siRNA

    GAUUGUUUUAUACAGCAAAtt

    CAAGGAUACCCGAAACCUAtt

    CUAAUUCAACUAAUGAGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"