NovoPro
Cart 2
  • CD80 Rhesus Monkey  cDNA/ORF Clones

CD80 Rhesus Monkey cDNA/ORF Clones

Cat.#: 717230-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD80 molecule
  • Organism
    Rhesus Monkey
  • Entrez Gene ID
  • Gene Symbol
    CD80
  • Gene Type
    protein coding
  • Also Known as
    B7.1
  • Encoded Protein Alias
    T-lymphocyte activation antigen CD80
  • Product Name
    CD80(NM_001042642) Rhesus Monkey cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Macaca mulatta CD80 molecule (CD80), mRNA.
  • Synonyms
  • ORF length
    867
  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"