NovoPro
Cart 2
  • CD80 Rabbit  cDNA/ORF Clones

CD80 Rabbit cDNA/ORF Clones

Cat.#: 721461-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 154.3 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD80 molecule
  • Organism
    Rabbit
  • Entrez Gene ID
  • Gene Symbol
    CD80
  • Gene Type
    protein coding
  • Encoded Protein Alias
    activation B7-1 antigen
  • Product Name
    CD80(NM_001082663) Rabbit cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Oryctolagus cuniculus CD80 molecule (CD80), mRNA.
  • Synonyms
  • ORF length
    900
  • DataSheet:
  • Product Name
    CD80(XM_008266820) Rabbit cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Oryctolagus cuniculus CD80 molecule (CD80), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    900
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"