NovoPro
Cart 2
  • Cd47 Rat  cDNA/ORF Clones

Cd47 Rat cDNA/ORF Clones

Cat.#: 707621-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 172.7 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    Cd47 molecule
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Cd47
  • Gene Type
    protein coding
  • Also Known as
    Itgp
  • Encoded Protein Alias
    leukocyte surface antigen CD47; CD47 antigen (Rh-related antigen, integrin-associated signal transducer); IAP; integrin-associated protein
  • Product Name
    Cd47(XM_006248268) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus Cd47 molecule (Cd47), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    921
  • siRNA

    GCAAAACAGUUAUAGAGCUtt

    GCUCAACUCCUGCUUAGUAtt

    GCAAAGUCCUUAAUGUGGAtt

  • DataSheet:
  • Product Name
    Cd47(XM_006248267) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus Cd47 molecule (Cd47), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    933
  • siRNA

    GCAAAACAGUUAUAGAGCUtt

    GCUCAACUCCUGCUUAGUAtt

    GCAAAGUCCUUAAUGUGGAtt

  • DataSheet:
  • Product Name
    Cd47(NM_019195) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus Cd47 molecule (Cd47), mRNA.
  • Synonyms
  • ORF length
    912
  • siRNA

    GCAAAACAGUUAUAGAGCUtt

    GCUCAACUCCUGCUUAGUAtt

    GCAAAGUCCUUAAUGUGGAtt

  • DataSheet:
  • Product Name
    Cd47(XM_006248262) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus Cd47 molecule (Cd47), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1080
  • siRNA

    GCAAAACAGUUAUAGAGCUtt

    GCUCAACUCCUGCUUAGUAtt

    GCAAAGUCCUUAAUGUGGAtt

  • DataSheet:
  • Product Name
    Cd47(XM_006248264) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus Cd47 molecule (Cd47), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1026
  • siRNA

    GCAAAACAGUUAUAGAGCUtt

    GCUCAACUCCUGCUUAGUAtt

    GCAAAGUCCUUAAUGUGGAtt

  • DataSheet:
  • Product Name
    Cd47(XM_006248263) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus Cd47 molecule (Cd47), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1047
  • siRNA

    GCAAAACAGUUAUAGAGCUtt

    GCUCAACUCCUGCUUAGUAtt

    GCAAAGUCCUUAAUGUGGAtt

  • DataSheet:
  • Product Name
    Cd47(XM_006248265) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus Cd47 molecule (Cd47), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1014
  • siRNA

    GCAAAACAGUUAUAGAGCUtt

    GCUCAACUCCUGCUUAGUAtt

    GCAAAGUCCUUAAUGUGGAtt

  • DataSheet:
  • Product Name
    Cd47(XM_006248266) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus Cd47 molecule (Cd47), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    966
  • siRNA

    GCAAAACAGUUAUAGAGCUtt

    GCUCAACUCCUGCUUAGUAtt

    GCAAAGUCCUUAAUGUGGAtt

  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"