NovoPro
Cart 2
  • Cd47 Mouse  cDNA/ORF Clones

Cd47 Mouse cDNA/ORF Clones

Cat.#: 708937-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 186.8 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD47 antigen (Rh-related antigen, integrin-associated signal transducer)
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Cd47
  • Gene Type
    protein coding
  • Also Known as
    IAP; Itgp; AA407862; AI848868; AW108519; 9130415E20Rik; B430305P08Rik
  • Encoded Protein Alias
    leukocyte surface antigen CD47; Rh-related antigen; integrin-associated protein
  • Product Name
    Cd47(XM_006521807) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    996
  • DataSheet:
  • Product Name
    Cd47(XM_006521806) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1029
  • DataSheet:
  • Product Name
    Cd47(XM_006521810) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    939
  • DataSheet:
  • Product Name
    Cd47(XM_006521808) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    966
  • DataSheet:
  • Product Name
    Cd47(XM_006521811) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    912
  • DataSheet:
  • Product Name
    Cd47(XM_006521809) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    963
  • DataSheet:
  • Product Name
    Cd47(NM_175169) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus CD47 antigen (Rh-related antigen, integrin-associated signal transducer) (Cd47), mRNA.
  • Synonyms
  • ORF length
    975
  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"