NovoPro
Cart 2
  • CD4 Rhesus Monkey  cDNA/ORF Clones

CD4 Rhesus Monkey cDNA/ORF Clones

Cat.#: 717221-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 144.8 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD4 molecule
  • Organism
    Rhesus Monkey
  • Entrez Gene ID
  • Gene Symbol
    CD4
  • Gene Type
    protein coding
  • Encoded Protein Alias
    CD4 antigen; T-cell surface antigen T4/Leu-3
  • Product Name
    CD4(NM_001042662) Rhesus Monkey cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Macaca mulatta CD4 molecule (CD4), mRNA.
  • Synonyms
  • ORF length
    1377
  • DataSheet:
  • Product Name
    CD4(XM_015150821) Rhesus Monkey cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Macaca mulatta CD4 molecule (CD4), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    558
  • DataSheet:
  • Product Name
    CD4(XM_015150820) Rhesus Monkey cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Macaca mulatta CD4 molecule (CD4), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    840
  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"