NovoPro
Cart 2
  • Cd38 Rat  cDNA/ORF Clones

Cd38 Rat cDNA/ORF Clones

Cat.#: 708376-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 165.9 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD38 molecule
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Cd38
  • Gene Type
    protein coding
  • Also Known as
    ADPRC 1
  • Encoded Protein Alias
    ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase 1; 2'-phospho-ADP-ribosyl cyclase; 2'-phospho-ADP-ribosyl cyclase/2'-phospho-cyclic-ADP-ribose transferase; 2'-phospho-cyclic-ADP-ribose transferase; ADP-ribosyl cyclase 1; CD38 antigen (ADP-ribosyl cyclase / cyclic ADP-ribose hydrolase); CD38H; cADPr hydrolase 1; cyclic ADP-ribose hydrolase 1
  • Product Name
    Cd38(XM_006251072) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus CD38 molecule (Cd38), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    885
  • siRNA

    GGAUAACUACCGACCUGUAtt

  • DataSheet:
  • Product Name
    Cd38(NM_013127) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus CD38 molecule (Cd38), mRNA.
  • Synonyms
  • ORF length
    912
  • siRNA

    GGAUAACUACCGACCUGUAtt

    GUGUGGAAGUCUUUAAUUUtt

    GGGUAAUGCAUGACAUUAAtt

  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"