NovoPro
Cart 2
  • CD38 Macaca fascicularis  cDNA/ORF Clones

CD38 Macaca fascicularis cDNA/ORF Clones

Cat.#: 700243-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 169.9 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD38 molecule
  • Organism
    Macaca fascicularis
  • Entrez Gene ID
  • Gene Symbol
    CD38
  • Gene Type
    protein coding
  • Also Known as
    ADPRC 1
  • Encoded Protein Alias
    ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase 1; 2'-phospho-ADP-ribosyl cyclase; 2'-phospho-ADP-ribosyl cyclase/2'-phospho-cyclic-ADP-ribose transferase; 2'-phospho-cyclic-ADP-ribose transferase; ADP-ribosyl cyclase 1; CD38 antigen; Cyclic ADP-ribose hydrolase 1; cADPr hydrolase 1
  • Product Name
    CD38(NM_001287277) Macaca fascicularis cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Macaca fascicularis CD38 molecule (CD38), mRNA.
  • Synonyms
  • ORF length
    906
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"