NovoPro
Cart 2
  • CD28 Macaca fascicularis  cDNA/ORF Clones

CD28 Macaca fascicularis cDNA/ORF Clones

Cat.#: 700029-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 132.2 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CD28 molecule
  • Organism
    Macaca fascicularis
  • Entrez Gene ID
  • Gene Symbol
    CD28
  • Gene Type
    protein coding
  • Also Known as
    MFASCD28-P
  • Encoded Protein Alias
    T-cell-specific surface glycoprotein CD28; CD28 precursor 6m; MFASCD28-6m
  • Product Name
    CD28(XM_015432133) Macaca fascicularis cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Macaca fascicularis CD28 molecule (CD28), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    705
  • DataSheet:
  • Product Name
    CD28(NM_001287333) Macaca fascicularis cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Macaca fascicularis CD28 molecule (CD28), mRNA.
  • Synonyms
  • ORF length
    663
  • DataSheet:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"