NovoPro
Cart 2
  • Ccng1 Mouse  cDNA/ORF Clones

Ccng1 Mouse cDNA/ORF Clones

Cat.#: 749658-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 151.7 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    cyclin G1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Ccng1
  • Gene Type
    protein coding
  • Also Known as
    AI314029
  • Encoded Protein Alias
    cyclin-G
  • Product Name
    Ccng1(NM_009831) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Mus musculus cyclin G1 (Ccng1), mRNA.
  • Synonyms
  • ORF length
    885
  • siRNA

    GAAGCACAGUUAUUAUAGAtt

    GACUAGAAGCCCAACUUAAtt

    GACAGAUUCUUGUCUAAAAtt

  • DataSheet:
  • Product Name
    Ccng1(XM_011248706) Mouse cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Mus musculus cyclin G1 (Ccng1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    564
  • siRNA
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"