Cart 2
  • CCDC149 Human  cDNA/ORF Clone

CCDC149 Human cDNA/ORF Clone

Cat.#: 743504-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 278.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    coiled-coil domain containing 149
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CCDC149
  • Gene Type
    protein coding
  • Encoded Protein Alias
    Coiled-coil domain-containing protein 149
  • Product Name
    CCDC149(NM_001330643) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens coiled-coil domain containing 149 (CCDC149), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1623
  • Annotation
    This variant (3) differs in the 5' UTR and 5' coding region, uses an alternate start codon, and contains an alternate in-frame exon in the 3' coding region, compared to variant 1. The encoded isoform (3) is longer and has a distinct N-terminus compared to isoform 1.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    CCDC149(NM_001130726) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens coiled-coil domain containing 149 (CCDC149), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1590
  • Annotation
    This variant (2) differs in the 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus but is overall the same length as isoform 1.
  • siRNA

    GCACAACUAUUGAGAGAUUtt

    GUACCUUCAAGAGAGAUUAtt

    GCUACUCCGCAGUCCAUUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CCDC149(NM_173463) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens coiled-coil domain containing 149 (CCDC149), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1590
  • Annotation
    This variant (1) represents the longest transcript and encodes isoform 1.
  • siRNA

    GCACAACUAUUGAGAGAUUtt

    GUACCUUCAAGAGAGAUUAtt

    GCUACUCCGCAGUCCAUUUtt

  • DataSheet:
  • FAQs:
  • Product Name
    CCDC149(NM_001330644) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens coiled-coil domain containing 149 (CCDC149), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1425
  • Annotation
    This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus compared to isoform 1.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    CCDC149(XM_011513906) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens coiled-coil domain containing 149 (CCDC149), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1623
  • siRNA

    GCACAACUAUUGAGAGAUUtt

    GUACCUUCAAGAGAGAUUAtt

    GCUACUCCGCAGUCCAUUUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"