Cart 2
  • CASK Fruit Fly  cDNA/ORF Clone

CASK Fruit Fly cDNA/ORF Clone

Cat.#: 748174-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 241.7 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    CASK ortholog
  • Organism
    Fruit Fly
  • Entrez Gene ID
  • Gene Symbol
    CASK
  • Gene Type
    protein coding
  • Also Known as
    caki; Caki; CAKI; camguk; Camguk; CamguK; CamGUK; CAMGUK; cask; Cask; CG13412; CG13413; CG6703; cmg; Cmg; CMG; CMG/CASK; dCASK; DLin-2; DmelCG6703; RE09582p
  • Encoded Protein Alias
    CASK ortholog; CASK-PA; CASK-PB; CASK-PD; CASK-PE; CASK-PF; CASK-PG; CASK-PH; CG6703-PA; CG6703-PB; CG6703-PD; CG6703-PE; CG6703-PF; CG6703-PG; CG6703-PH; Calcium/calmodulin-dependent protein kinase; Camguk/CASK adaptor protein; calmodulin-dependent kinase; camguk
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"