NovoPro
Cart 2
  • CAMK2D Rabbit  cDNA/ORF Clones

CAMK2D Rabbit cDNA/ORF Clones

Cat.#: 721017-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 257.1 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcium/calmodulin dependent protein kinase II delta
  • Organism
    Rabbit
  • Entrez Gene ID
  • Gene Symbol
    CAMK2D
  • Gene Type
    protein coding
  • Encoded Protein Alias
    CaM kinase II subunit delta; CaMK-II subunit delta; calmodulin-dependent protein kinase II-delta dash
  • Product Name
    CAMK2D(NM_001099954) Rabbit cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Oryctolagus cuniculus calcium/calmodulin dependent protein kinase II delta (CAMK2D), mRNA.
  • Synonyms
  • ORF length
    1500
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"