Cart 2
  • CASK Human  cDNA/ORF Clone

CASK Human cDNA/ORF Clone

Cat.#: 715637-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 476.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcium/calmodulin dependent serine protein kinase
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CASK
  • Gene Type
    protein coding
  • Also Known as
    CMG; FGS4; LIN2; TNRC8; CAGH39; CAMGUK; MICPCH; MRXSNA
  • Encoded Protein Alias
    calcium/calmodulin-dependent serin protein kinase; calcium/calmodulin-dependent serine protein kinase membrane-associated guanylate kinase; hCASK; protein lin-2 homolog; trinucleotide repeat containing 8
  • Product Name
    CASK(XM_011543997) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent serine protein kinase (CASK), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    2208
  • siRNA

    GAGUUCGGCUGGUACAGUUtt

    GGACGACAGAUCUAUGUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CASK(XM_006724566) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent serine protein kinase (CASK), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    2658
  • siRNA

    GAGUUCGGCUGGUACAGUUtt

    GCUUUACAUGGUUUUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CASK(NM_001126055) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium/calmodulin dependent serine protein kinase (CASK), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2694
  • Annotation
    This variant (3) lacks two alternate in-frame exons and use an alternate in-frame splice site compared to variant 1. The resulting protein (isoform 3) is shorter compared to isoform 1.
  • siRNA

    GAGUUCGGCUGGUACAGUUtt

    GCUUUACAUGGUUUUCGAAtt

    GGACGACAGAUCUAUGUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CASK(XM_011543994) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent serine protein kinase (CASK), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2745
  • siRNA

    GAGUUCGGCUGGUACAGUUtt

    GCUUUACAUGGUUUUCGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CASK(NM_003688) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium/calmodulin dependent serine protein kinase (CASK), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2766
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest protein (isoform 1).
  • siRNA

    GAGUUCGGCUGGUACAGUUtt

    GCUUUACAUGGUUUUCGAAtt

    GGACGACAGAUCUAUGUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CASK(XM_011543995) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent serine protein kinase (CASK), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2712
  • siRNA

    GAGUUCGGCUGGUACAGUUtt

    GCUUUACAUGGUUUUCGAAtt

    GGACGACAGAUCUAUGUAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    CASK(XM_011543996) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent serine protein kinase (CASK), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    2676
  • siRNA

    GAGUUCGGCUGGUACAGUUtt

    GCUUUACAUGGUUUUCGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCR4-TOPO
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3956
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    None
  • Description
    TOPO Cloning vector with ampicillin resistance in bacteria.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"