NovoPro
Cart 2
  • CAMK4 Human  cDNA/ORF Clones

CAMK4 Human cDNA/ORF Clones

Cat.#: 714761-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 142.4 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcium/calmodulin dependent protein kinase IV
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CAMK4
  • Gene Type
    protein coding
  • Also Known as
    caMK; CaMK IV; CaMK-GR
  • Encoded Protein Alias
    calcium/calmodulin-dependent protein kinase type IV; CAM kinase IV; CAM kinase- GR; brain Ca(2+)-calmodulin-dependent protein kinase type IV; brain Ca++-calmodulin-dependent protein kinase type IV; caM kinase-GR; calcium/calmodulin-dependent protein kinase type IV catalytic chain
  • Product Name
    CAMK4(NM_001323377) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium/calmodulin dependent protein kinase IV (CAMK4), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    831
  • siRNA

    CUCUCAAAGUGUUAAAGAAtt

    CGUAAGAACUGAGAUAGGAtt

    GCAGAUGCCGUUAAACAAAtt

  • DataSheet:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"