NovoPro
Cart 2
  • CAMK2G Human  cDNA/ORF Clones

CAMK2G Human cDNA/ORF Clones

Cat.#: 714905-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 277.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    calcium/calmodulin dependent protein kinase II gamma
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    CAMK2G
  • Gene Type
    protein coding
  • Also Known as
    CAMK; CAMKG; CAMK-II
  • Encoded Protein Alias
    calcium/calmodulin-dependent protein kinase type II subunit gamma; caMK-II subunit gamma; calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma
  • Product Name
    CAMK2G(NM_214193) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    1620
  • Annotation
    This variant (7) has an alternate in-frame exon and lacks an alternate in-frame exon compared to variant 1. The resulting protein (isoform 7) is shorter and lacks two internal segments compared to isoform 1.
  • siRNA
  • DataSheet:
  • Product Name
    CAMK2G(NM_172169) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1584
  • Annotation
    This variant (2) has multiple coding region differences, compared to variant 1. This results in a shorter isoform (2), compared to isoform 1.
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(NM_001222) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1488
  • Annotation
    This variant (4) lacks in-frame segments of the coding region, compared to variant 1. It encodes a shorter isoform (4), that is missing internal segments compared to isoform 1.
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • DataSheet:
  • Product Name
    CAMK2G(XM_011540225) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    1728
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_006717996) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    1704
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_006717998) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X24, mRNA.
  • Synonyms
  • ORF length
    1611
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_005270200) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X22, mRNA.
  • Synonyms
  • ORF length
    1635
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016732) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X31, mRNA.
  • Synonyms
  • ORF length
    1536
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_005270198) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    1692
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(NM_172171) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1671
  • Annotation
    This variant (1) represents the longest transcript and encodes isoform 1.
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016739) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X43, mRNA.
  • Synonyms
  • ORF length
    1095
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016725) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    1716
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016726) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    1710
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(NM_001320898) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    1779
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016734) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X33, mRNA.
  • Synonyms
  • ORF length
    1533
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_005270195) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1734
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016735) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X34, mRNA.
  • Synonyms
  • ORF length
    1521
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016733) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X32, mRNA.
  • Synonyms
  • ORF length
    1533
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016717) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1824
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_005671076) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1767
  • siRNA
  • DataSheet:
  • Product Name
    CAMK2G(XM_017016719) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1806
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016723) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1752
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_005671078) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    1698
  • siRNA
  • DataSheet:
  • Product Name
    CAMK2G(XM_017016737) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X37, mRNA.
  • Synonyms
  • ORF length
    1506
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016730) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X29, mRNA.
  • Synonyms
  • ORF length
    1548
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016722) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1773
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016724) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    1746
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_005270199) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    1665
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016721) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1785
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016729) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X25, mRNA.
  • Synonyms
  • ORF length
    1602
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016731) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X30, mRNA.
  • Synonyms
  • ORF length
    1539
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016720) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1785
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_005270201) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X23, mRNA.
  • Synonyms
  • ORF length
    1629
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016728) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X21, mRNA.
  • Synonyms
  • ORF length
    1647
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016716) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1848
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016736) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X35, mRNA.
  • Synonyms
  • ORF length
    1521
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016727) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    1683
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(NM_172173) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1515
  • Annotation
    This variant (6) lacks in-frame segments of the coding region, compared to variant 1. It encodes a shorter isoform (6), that is missing internal segments compared to isoform 1.
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016738) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X42, mRNA.
  • Synonyms
  • ORF length
    1182
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Product Name
    CAMK2G(XM_017016718) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase II gamma (CAMK2G), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1815
  • siRNA

    GAAAGAUCCCUAUGGAAAAtt

    CGAAAACAGGAGAUCAUUAtt

    ACCAGAAACUAGAACGUGAtt

    GAUCAUUAAGAUUACAGAAtt

  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC18c
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2693
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pMD18-T Vector is a high-efficiency TA cloning vector constructed from pUC18, of which the initial multiple cloning sites (MCS) were destroyed. Thus the cDNA should be amplified by PCR with primers containing a restriction site for subclone. Competent cells appropriate for pUC18 are also appropriated for this Vector, e.g. JM109, DH5α, TOP10. The pMD18-T Simple Vector is 2.6kb in size. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene. The coding sequence was inserted by TA cloning at site 425.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"