NovoPro
Cart 2
  • BORCS7 Pongo abelii  cDNA/ORF Clones

BORCS7 Pongo abelii cDNA/ORF Clones

Cat.#: 721711-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    BLOC-1 related complex subunit 7
  • Organism
    Pongo abelii
  • Entrez Gene ID
  • Gene Symbol
    BORCS7
  • Gene Type
    protein coding
  • Also Known as
    C10orf32
  • Encoded Protein Alias
    Uncharacterized protein C10orf32 homolog
  • Product Name
    BORCS7(XM_009245743) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Pongo abelii chromosome 10 open reading frame, human C10orf32 (C10H10orf32), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    582
  • DataSheet:
  • Product Name
    BORCS7(NM_001131358) Pongo abelii cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Pongo abelii BLOC-1 related complex subunit 7 (BORCS7), mRNA.
  • Synonyms
  • ORF length
    321
  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"