NovoPro
Cart 2
  • Vegfd Rat  cDNA/ORF Clones

Vegfd Rat cDNA/ORF Clones

Cat.#: 701181-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 183.9 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    vascular endothelial growth factor D
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Vegfd
  • Gene Type
    protein coding
  • Also Known as
    Figf; Vegf-d
  • Encoded Protein Alias
    vascular endothelial growth factor D; c-fos-induced growth factor
  • Product Name
    Vegfd(XM_006256863) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus c-fos induced growth factor (Figf), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    981
  • siRNA

    CACUAAAAGUUAUAGAUGAtt

    CCAGAUUUGCGGCAACUUUtt

    GCUGUGGGAUAACACCAAAtt

  • DataSheet:
  • Product Name
    Vegfd(NM_031761) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor D (Vegfd), mRNA.
  • Synonyms
    XM_346872  
  • ORF length
    981
  • siRNA

    CACUAAAAGUUAUAGAUGAtt

    CCAGAUUUGCGGCAACUUUtt

    GCUGUGGGAUAACACCAAAtt

  • DataSheet:
  • Product Name
    Vegfd(XM_006256864) Rat cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus c-fos induced growth factor (Figf), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    966
  • siRNA

    CACUAAAAGUUAUAGAUGAtt

    CCAGAUUUGCGGCAACUUUtt

    GCUGUGGGAUAACACCAAAtt

  • DataSheet:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"