NovoPro
Cart 2
  • BTN3A1 Human  cDNA/ORF Clones

BTN3A1 Human cDNA/ORF Clones

Cat.#: 715583-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 260.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    butyrophilin subfamily 3 member A1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    BTN3A1
  • Gene Type
    protein coding
  • Also Known as
    BTF5; BT3.1; CD277; BTN3.1
  • Encoded Protein Alias
    butyrophilin, subfamily 3, member A1; dJ45P21.3 (butyrophilin, subfamily 3, member A1)
  • Product Name
    BTN3A1(XM_005248833) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens butyrophilin subfamily 3 member A1 (BTN3A1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1521
  • siRNA

    GAAUAAGUAUCGGACUCUAtt

    GCUGUGGAUGGAUCGCAUAtt

  • DataSheet:
  • Product Name
    BTN3A1(NM_194441) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens butyrophilin subfamily 3 member A1 (BTN3A1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1059
  • Annotation
    This variant (2) differs in the 5' and 3' UTRs, and uses an alternate splice site in the 3' coding region, compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a.
  • siRNA

    GAAUAAGUAUCGGACUCUAtt

    GCUGUGGAUGGAUCGCAUAtt

    GCACAAGAGUGAAGCUCCUtt

  • DataSheet:
  • Product Name
    BTN3A1(NM_001145009) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens butyrophilin subfamily 3 member A1 (BTN3A1), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1137
  • Annotation
    This variant (4) uses an alternate splice site in the 3' coding region that results in a frameshift, compared to variant 1. The resulting isoform (d) has a distinct C-terminus and is shorter than isoform a.
  • siRNA

    GAAUAAGUAUCGGACUCUAtt

    GCUGUGGAUGGAUCGCAUAtt

    GCACAAGAGUGAAGCUCCUtt

  • DataSheet:
  • Product Name
    BTN3A1(XM_006714983) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens butyrophilin subfamily 3 member A1 (BTN3A1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1260
  • siRNA

    GAAUAAGUAUCGGACUCUAtt

    GCUGUGGAUGGAUCGCAUAtt

    GCACAAGAGUGAAGCUCCUtt

  • DataSheet:
  • Product Name
    BTN3A1(NM_001145008) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens butyrophilin subfamily 3 member A1 (BTN3A1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1386
  • Annotation
    This variant (3) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (c) that is shorter than isoform a.
  • siRNA

    GAAUAAGUAUCGGACUCUAtt

    GCUGUGGAUGGAUCGCAUAtt

    GCACAAGAGUGAAGCUCCUtt

  • DataSheet:
  • Product Name
    BTN3A1(NM_007048) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens butyrophilin subfamily 3 member A1 (BTN3A1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1542
  • Annotation
    This variant (1) encodes the longest isoform (a).
  • siRNA

    GAAUAAGUAUCGGACUCUAtt

    GCUGUGGAUGGAUCGCAUAtt

    GCACAAGAGUGAAGCUCCUtt

  • DataSheet:
  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"