NovoPro
Cart 2
  • BIN1 Human  cDNA/ORF Clones

BIN1 Human cDNA/ORF Clones

Cat.#: 714868-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 289.1 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    bridging integrator 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    BIN1
  • Gene Type
    protein coding
  • Also Known as
    AMPH2; AMPHL; SH3P9
  • Encoded Protein Alias
    myc box-dependent-interacting protein 1; amphiphysin II; amphiphysin-like protein; box dependant MYC interacting protein 1; box-dependent myc-interacting protein 1
  • Product Name
    BIN1(NM_001320640) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 11, mRNA.
  • Synonyms
  • ORF length
    1542
  • Annotation
    This variant (11) lacks three alternate in-frame exons compared to variant 1. The resulting isoform (11) has the same N- and C-termini but is shorter compared to isoform 1.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_004305) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    1365
  • Annotation
    This variant (8) lacks five in-frame exons and has an additional in-frame exon in the coding region, compared to variant 1. Isoform 8 is shorter than isoform 1. It is expressed in muscle and localizes to the nucleus.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_001320641) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 12, mRNA.
  • Synonyms
  • ORF length
    1689
  • Annotation
    This variant (12) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (12) has the same N- and C-termini but is shorter compared to isoform 1.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_139347) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    1557
  • Annotation
    This variant (5) lacks three in-frame exons in the coding region, compared to variant 1. Isoform 5, also called IIb, is shorter than isoform 1 and binds dynamin, synaptojanin, and endophilin.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_005263645) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    1662
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_017003828) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X23, mRNA.
  • Synonyms
  • ORF length
    1110
  • siRNA

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_017003821) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X14, mRNA.
  • Synonyms
  • ORF length
    1452
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_006712427) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X8, mRNA.
  • Synonyms
  • ORF length
    1617
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_011510975) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    1746
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_139343) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1782
  • Annotation
    This variant (1) encodes the longest isoform, which is cytoplasmic. Isoform 1, also called IIa and S11R3-a, binds dynamin, synaptojanin, and clathrin. This isoform is expressed exclusively in the brain and is concentrated in nerve terminals.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_017003822) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X16, mRNA.
  • Synonyms
  • ORF length
    1359
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_006712432) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    1458
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_139348) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1449
  • Annotation
    This variant (6) lacks four in-frame exons in the coding region, compared to variant 1. Isoform 6, also called subtype 2, is shorter than isoform 1.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_139345) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    1521
  • Annotation
    This variant (3) lacks three in-frame exons in the coding region, compared to variant 1. Isoform 3, also called IIc1, is shorter than isoform 1 and binds dynamin and synaptojanin.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_017003827) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X22, mRNA.
  • Synonyms
  • ORF length
    1155
  • siRNA

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_139346) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    1494
  • Annotation
    This variant (4) lacks four in-frame exons and has an additional in-frame exon in the coding region, compared to variant 1. Isoform 4 is shorter than isoform 1.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_139349) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    1428
  • Annotation
    This variant (7) lacks three in-frame exons in the coding region, compared to variant 1. Isoform 7, also called IIc2 and S1/R3-c, is shorter than isoform 1 and binds dynamin and synaptojanin.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_006712433) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X15, mRNA.
  • Synonyms
  • ORF length
    1368
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_001320634) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 16, mRNA.
  • Synonyms
  • ORF length
    1158
  • Annotation
    This variant (16) differs in the 5' UTR and coding sequence and lacks six alternate in-frame exons compared to variant 1. The resulting isoform (16) is shorter and has a distinct N-terminus compared to isoform 1.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_006712431) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X12, mRNA.
  • Synonyms
  • ORF length
    1497
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_006712429) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    1566
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_017003825) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X20, mRNA.
  • Synonyms
  • ORF length
    1251
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_017003823) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X17, mRNA.
  • Synonyms
  • ORF length
    1356
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_001320632) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 13, mRNA.
  • Synonyms
  • ORF length
    1275
  • Annotation
    This variant (13) lacks six alternate in-frame exons and contains another alternate in-frame exon compared to variant 1. The resulting isoform (13) has the same N- and C-termini but is shorter compared to isoform 1.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_006712428) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1587
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_017003819) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1755
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_139350) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    1320
  • Annotation
    This variant (9) lacks five in-frame exons in the coding region, compared to variant 1. Isoform 9, also called BIN1-10, is shorter than isoform 1 and is ubiquitously expressed.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_017003820) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X11, mRNA.
  • Synonyms
  • ORF length
    1557
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_001320633) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 14, mRNA.
  • Synonyms
  • ORF length
    1413
  • Annotation
    This variant (14) lacks four alternate in-frame exons compared to variant 1. The resulting isoform (14) has the same N- and C-termini but is shorter compared to isoform 1.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_005263642) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1827
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_139351) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 10, mRNA.
  • Synonyms
  • ORF length
    1230
  • Annotation
    This variant (10) lacks six in-frame exons in the coding region, compared to variant 1. Isoform 10, also called BIN1-10-13, is shorter than isoform 1 and is ubiquitously expressed.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_139344) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1653
  • Annotation
    This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. Isoform 2, also called IId and S1/R3-6, is shorter than isoform 1 and binds dynamin, synaptojanin, and clathrin.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_006712426) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1695
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_006712434) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X18, mRNA.
  • Synonyms
  • ORF length
    1323
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_006712425) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    1695
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_005263643) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    1734
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_017003826) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X21, mRNA.
  • Synonyms
  • ORF length
    1248
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(XM_017003824) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens bridging integrator 1 (BIN1), transcript variant X19, mRNA.
  • Synonyms
  • ORF length
    1287
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Product Name
    BIN1(NM_001320642) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens bridging integrator 1 (BIN1), transcript variant 15, mRNA.
  • Synonyms
  • ORF length
    1701
  • Annotation
    This variant (15) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (15) has a shorter and distinct N-terminus compared to isoform 1.
  • siRNA

    AGGUUUCAUGUUCAAGGUAtt

    GGAGGUGUAUGAGCCCGAUtt

    AGAUCGCAGAGAACAACGAtt

  • DataSheet:
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.
  • Antibodies
  • Recombinant Proteins
  • cDNA Clones

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"