NovoPro
Cart 2
  • BCAR1 Human  cDNA/ORF Clones

BCAR1 Human cDNA/ORF Clones

Cat.#: 710921-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 423.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    BCAR1, Cas family scaffolding protein
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    BCAR1
  • Gene Type
    protein coding
  • Also Known as
    CAS; CAS1; CASS1; CRKAS; P130Cas
  • Encoded Protein Alias
    breast cancer anti-estrogen resistance protein 1; Cas scaffolding protein family member 1; Crk-associated substrate p130Cas
  • Product Name
    BCAR1(XM_017023899) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    2472
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

  • DataSheet:
  • Product Name
    BCAR1(NM_001170716) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    2667
  • Annotation
    This variant (3) has an alternate 5' sequence, as compared to variant 1. The resulting isoform (3) is shorter and has a different N-terminus, as compared to isoform 1.
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(XM_017023898) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant X3, mRNA.
  • Synonyms
  • ORF length
    2661
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(XM_005256258) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    2691
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(XM_005256259) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant X4, mRNA.
  • Synonyms
  • ORF length
    2613
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(NM_001170721) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant 9, mRNA.
  • Synonyms
  • ORF length
    1983
  • Annotation
    This variant (9) has an alternate 5' sequence, as compared to variant 1. The resulting isoform (9) is much shorter at the N-terminus, as compared to isoform 1.
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(NM_001170718) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    2613
  • Annotation
    This variant (5) lacks an exon in the 5' region, resulting in an alternate AUG start codon, as compared to variant 1. The resulting isoform (5) is shorter and has a different N-terminus, as compared to isoform 1.
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(XM_011523475) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    2526
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(NM_001170720) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    2169
  • Annotation
    This variant (8) has an alternate internal sequence, as compared to variant 1. The resulting isoform (8) is shorter and has a different N-terminus, as compared to isoform 1.
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(NM_001170717) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    2667
  • Annotation
    This variant (4) has an alternate 5' sequence and an alternate splice site in the CDS, as compared to variant 1. The resulting isoform (4) is shorter, and has a different N-terminus and an additional segment in the middle region, as compared to isoform 1.
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(NM_001170714) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2751
  • Annotation
    This variant (1) encodes the longest isoform (1).
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(NM_001170715) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    2667
  • Annotation
    This variant (2) has an alternate 5' sequence, as compared to variant 1. The resulting isoform (2) is shorter and has a different N-terminus, as compared to isoform 1.
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(NM_014567) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    2613
  • Annotation
    This variant (6) has an alternate 5' sequence, as compared to variant 1. The resulting isoform (6) is shorter and has a different N-terminus, as compared to isoform 1.
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Product Name
    BCAR1(NM_001170719) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BCAR1, Cas family scaffolding protein (BCAR1), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    2607
  • Annotation
    This variant (7) has an alternate 5' sequence, as compared to variant 1. The resulting isoform (7) is shorter and has a different N-terminus, as compared to isoform 1.
  • siRNA

    CUAUGACUACGUCCACCUAtt

    GGAUGGAGGACUAUGACUAtt

    GAGUUUGAGAAGACCCAGAtt

    GAGCAGGACGAGUACGACAtt

  • DataSheet:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"