NovoPro
Cart 2
  • BRCC3 Human  cDNA/ORF Clones

BRCC3 Human cDNA/ORF Clones

Cat.#: 715487-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 275.8 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    BRCA1/BRCA2-containing complex subunit 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    BRCC3
  • Gene Type
    protein coding
  • Also Known as
    C6.1A; BRCC36; CXorf53
  • Encoded Protein Alias
    BRCA1-A complex subunit BRCC36; BRCA1/BRCA2-containing complex subunit 36; BRCA1/BRCA2-containing complex, subunit 3; BRISC complex subunit BRCC36
  • Product Name
    BRCC3(NM_024332) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BRCA1/BRCA2-containing complex subunit 3 (BRCC3), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    951
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1).
  • siRNA

    GCAUUUGCAGGAAUUACAAtt

    CACAGUUGCUGAAAAGGUUtt

    CACUUGCUUCCAAUCCAUAtt

  • DataSheet:
  • DataSheet:
  • DataSheet:
  • DataSheet:
  • Product Name
    BRCC3(NM_001242640) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BRCA1/BRCA2-containing complex subunit 3 (BRCC3), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    879
  • Annotation
    This variant (3) uses an alternate in-frame splice site in the 5' coding region, and lacks an alternate in-frame exon in the central coding region, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
  • siRNA

    GCAUUUGCAGGAAUUACAAtt

    CACAGUUGCUGAAAAGGUUtt

    CACUUGCUUCCAAUCCAUAtt

  • DataSheet:
  • Product Name
    BRCC3(XM_005274751) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens BRCA1/BRCA2-containing complex subunit 3 (BRCC3), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    954
  • siRNA

    ACAGCUAUUGGUUAUUGUAtt

    GGUAUAGAAUGAGAUUAGAtt

    GACUCUCAUGGUAACUGUAtt

    CCAUCACCUUCUAAACUAUtt

    GGUUUUCAAUCUAAACUAUtt

    GCAAAUAACUAAGUUGAUUtt

    GUAAAUCUGUUGAGGAAAAtt

    GGUACAUGGAGGUGUCAAAtt

    CUCCUAUAAUUUCAACUCAtt

    GAUUCUCUAUUCUCAAUCAtt

    GCAUUUGCAGGAAUUACAAtt

    CACAGUUGCUGAAAAGGUUtt

    CACUUGCUUCCAAUCCAUAtt

  • DataSheet:
  • Product Name
    BRCC3(NM_001018055) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens BRCA1/BRCA2-containing complex subunit 3 (BRCC3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    876
  • Annotation
    This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.
  • siRNA

    GCAUUUGCAGGAAUUACAAtt

    CACAGUUGCUGAAAAGGUUtt

    CACUUGCUUCCAAUCCAUAtt

  • DataSheet:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"